Review




Structured Review

GSL Biotech primer3plus v2.4.0
Primer3plus V2.4.0, supplied by GSL Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer3plus+v2%2E4%2E0/primer3plus+v2+4+0/pmc05772224-505-67-77
Average 90 stars, based on 1 article reviews
primer3plus v2.4.0 - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Sequencing:

Article Title: Genetic Plasticity and Ethylmalonyl Coenzyme A Pathway during Acetate Assimilation in Rhodospirillum rubrum S1H under Photoheterotrophic Conditions
Article Snippet: TABLE 3 Source Name b Sequence, 5′–3′ c E. coli K-12 MC1061 pACY177 Km_Fw TCTCTGATGTTACATTGCAC Km_Rv CAGCGTAATGCTCTGC LKm_Rv GATTGTCGCACCTGATTGCC E. coli K-12 MA8 pKNOCK-Gm pKNOCK_Fw CATAAGCCTGTTCGGT pKNOCK_Rv CGGGGGATCCACTAG Rhodospirillum rubrum S1H Genomic DNA ccrHR1_Fw AGAACTAGTGGATCC GGCGTTCTTTGACAAGACCA ccrHR1_Rv AATGTAACATCAGAGA GTTGAAACCTCTAGGCCGCT ccrHR2_Fw GCAGAGCATTACGCTG AAGAGGTGCGCAAGTTCG ccrHR2_Rv ACCGAACAGGCTTA TGTCGCTCAGGTGCCATTC LKm_Fw TATCGGCGCCTTCGGTGTAT Ccr_Fw GTCAACTACAACGGGATCTGGG Ccr_Rv GAAATCGCGCTTGGTCTCATC Glts_Fw GATCGGCTATTGCAACTGCG Glts_Rv CAGATCCTCCATCGACTGGC Open in a separate window a All the oligonucleotides were designed using Primer3Plus v2.4.0 and checked for specificity using Snapgene Viewer software (GSL Biotech) and for the formation of dimers and secondary structures using the Multiple Primer Analyzer webtool (ThermoFisher Scientific) and were obtained from Eurogentec S.A. b Fw, forward primer; Rv, reverse primer. c Nucleotide sequences based on the sequences of the pACY117 plasmid (GenBank accession no. X06402.1 ), the pKNOCK-Gm plasmid, and Rhodospirillum rubrum strain ATCC 11170 (NCBI reference sequence; NC_007643.1 ).

Software:

Article Title: Genetic Plasticity and Ethylmalonyl Coenzyme A Pathway during Acetate Assimilation in Rhodospirillum rubrum S1H under Photoheterotrophic Conditions
Article Snippet: TABLE 3 Source Name b Sequence, 5′–3′ c E. coli K-12 MC1061 pACY177 Km_Fw TCTCTGATGTTACATTGCAC Km_Rv CAGCGTAATGCTCTGC LKm_Rv GATTGTCGCACCTGATTGCC E. coli K-12 MA8 pKNOCK-Gm pKNOCK_Fw CATAAGCCTGTTCGGT pKNOCK_Rv CGGGGGATCCACTAG Rhodospirillum rubrum S1H Genomic DNA ccrHR1_Fw AGAACTAGTGGATCC GGCGTTCTTTGACAAGACCA ccrHR1_Rv AATGTAACATCAGAGA GTTGAAACCTCTAGGCCGCT ccrHR2_Fw GCAGAGCATTACGCTG AAGAGGTGCGCAAGTTCG ccrHR2_Rv ACCGAACAGGCTTA TGTCGCTCAGGTGCCATTC LKm_Fw TATCGGCGCCTTCGGTGTAT Ccr_Fw GTCAACTACAACGGGATCTGGG Ccr_Rv GAAATCGCGCTTGGTCTCATC Glts_Fw GATCGGCTATTGCAACTGCG Glts_Rv CAGATCCTCCATCGACTGGC Open in a separate window a All the oligonucleotides were designed using Primer3Plus v2.4.0 and checked for specificity using Snapgene Viewer software (GSL Biotech) and for the formation of dimers and secondary structures using the Multiple Primer Analyzer webtool (ThermoFisher Scientific) and were obtained from Eurogentec S.A. b Fw, forward primer; Rv, reverse primer. c Nucleotide sequences based on the sequences of the pACY117 plasmid (GenBank accession no. X06402.1 ), the pKNOCK-Gm plasmid, and Rhodospirillum rubrum strain ATCC 11170 (NCBI reference sequence; NC_007643.1 ).

Plasmid Preparation:

Article Title: Genetic Plasticity and Ethylmalonyl Coenzyme A Pathway during Acetate Assimilation in Rhodospirillum rubrum S1H under Photoheterotrophic Conditions
Article Snippet: TABLE 3 Source Name b Sequence, 5′–3′ c E. coli K-12 MC1061 pACY177 Km_Fw TCTCTGATGTTACATTGCAC Km_Rv CAGCGTAATGCTCTGC LKm_Rv GATTGTCGCACCTGATTGCC E. coli K-12 MA8 pKNOCK-Gm pKNOCK_Fw CATAAGCCTGTTCGGT pKNOCK_Rv CGGGGGATCCACTAG Rhodospirillum rubrum S1H Genomic DNA ccrHR1_Fw AGAACTAGTGGATCC GGCGTTCTTTGACAAGACCA ccrHR1_Rv AATGTAACATCAGAGA GTTGAAACCTCTAGGCCGCT ccrHR2_Fw GCAGAGCATTACGCTG AAGAGGTGCGCAAGTTCG ccrHR2_Rv ACCGAACAGGCTTA TGTCGCTCAGGTGCCATTC LKm_Fw TATCGGCGCCTTCGGTGTAT Ccr_Fw GTCAACTACAACGGGATCTGGG Ccr_Rv GAAATCGCGCTTGGTCTCATC Glts_Fw GATCGGCTATTGCAACTGCG Glts_Rv CAGATCCTCCATCGACTGGC Open in a separate window a All the oligonucleotides were designed using Primer3Plus v2.4.0 and checked for specificity using Snapgene Viewer software (GSL Biotech) and for the formation of dimers and secondary structures using the Multiple Primer Analyzer webtool (ThermoFisher Scientific) and were obtained from Eurogentec S.A. b Fw, forward primer; Rv, reverse primer. c Nucleotide sequences based on the sequences of the pACY117 plasmid (GenBank accession no. X06402.1 ), the pKNOCK-Gm plasmid, and Rhodospirillum rubrum strain ATCC 11170 (NCBI reference sequence; NC_007643.1 ).



Similar Products

90
GSL Biotech primer3plus v2.4.0
Primer3plus V2.4.0, supplied by GSL Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer3plus+v2%2E4%2E0/primer3plus+v2+4+0/pmc05772224-505-67-77
Average 90 stars, based on 1 article reviews
primer3plus v2.4.0 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results